View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0769_low_48 (Length: 241)

Name: NF0769_low_48
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0769_low_48
NF0769_low_48
[»] chr7 (1 HSPs)
chr7 (31-93)||(36998286-36998348)


Alignment Details
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 31 - 93
Target Start/End: Original strand, 36998286 - 36998348
Alignment:
31 agcgagtataatttatgtataattattaaactctcctaattttttatttattcaagcaaagtg 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36998286 agcgagtataatttatgtataattattaaactctcctaattttttatttattcaagcaaagtg 36998348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University