View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0769_low_57 (Length: 209)
Name: NF0769_low_57
Description: NF0769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0769_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 44048680 - 44048860
Alignment:
| Q |
1 |
tgggctacaatctttttatttttaataaactaagatatcatgtacgtacaactgcaaagtctaattcatttaatggtcaagcatatgttttttcttaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44048680 |
tgggctacaatctttttatttttaataaactaagatatcatgtacgtacaactgcaaagtctaattcatttaatggtcaagcatatgttttttcttaggt |
44048779 |
T |
|
| Q |
101 |
tgtgagagatcaaccctgtaccaaatggttaaggaatacaaatatctaccacttgtgtctaccatctactcgttattatat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44048780 |
tgtgagagatcaaccctgtaccaaatggttaaggaatacaaatatctaccacttatgtctaccatctactcgttattatat |
44048860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 156
Target Start/End: Original strand, 20459481 - 20459517
Alignment:
| Q |
120 |
accaaatggttaaggaatacaaatatctaccacttgt |
156 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20459481 |
accaaatggttaagagatacaaatatctaccacttgt |
20459517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5129 times since January 2019
Visitors: 4845