View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0770_low_10 (Length: 318)
Name: NF0770_low_10
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0770_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 2244457 - 2244218
Alignment:
Q |
1 |
tcagaacctgaaatttgtcactcaccactgagttgaaaaaacaaatcaactccgcagctttccctttaccgtcgagtgaatcagtgcaactcggcgttct |
100 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2244457 |
tcagaacctgaaatttgtcactcactactgagttgaaaaaacaaatcaactccgtagctttccctttaccgtcgagtgaatcagtgcaactcggcgttct |
2244358 |
T |
 |
Q |
101 |
ccacagctaggaattgagcgtgaaggattgtgcagtcagtaaatgaaacctagcaattctcaaatgaaaataaaaattagtaatttagtaacataatgct |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2244357 |
ccacagctaggaattgagcgtgaaggattgtgcagtcagtaaatgaaacctagcaattctcaaatgaaaataaaaattagtaatttagtaacataatgct |
2244258 |
T |
 |
Q |
201 |
acctagaatcaaaagattaagccaaaagaatcctctctct |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2244257 |
acctagaatcaaaagattaagccaaaagaatcctctctct |
2244218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University