View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0770_low_11 (Length: 316)

Name: NF0770_low_11
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0770_low_11
NF0770_low_11
[»] chr8 (1 HSPs)
chr8 (44-229)||(38426709-38426894)


Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 44 - 229
Target Start/End: Complemental strand, 38426894 - 38426709
Alignment:
44 agacccaaaaatcaattttacggagcaagagcctatcaagacaaccgctgacaaatttttgggatcagttaaagaaaatttatcaccacatgatatgaag 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38426894 agacccaaaaatcaattttacggagcaagagcctatcaagacaaccgctgacaaatttttgggatcagttaaagaaaatttatcaccacatgatatgaag 38426795  T
144 cgactagaggcttatgttgacaatcttgctgactttcatctggtaatttctcaaatgatggataccattctttttacttgatgatg 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38426794 cgactagaggcttatgttgacaatcttgctgactttcatctggtaatttctcaaatgatggataccattctttttacttgatgatg 38426709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University