View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0770_low_16 (Length: 284)
Name: NF0770_low_16
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0770_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 40 - 237
Target Start/End: Complemental strand, 55314168 - 55313969
Alignment:
| Q |
40 |
aggtactatatatcaaacaaaacnnnnnnntatgttaaaagtgtgt--tttgcttgcatgatggtaatgtacaatagagtaataaatgacctgtagagca |
137 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55314168 |
aggtactatatatcaaacaaaacaaaaagacaagttaaaagtgtgtgttttgcttgcatgatggtaatgtacaatagagtaataaatgacctgtagagca |
55314069 |
T |
|
| Q |
138 |
agtagagttctctcgtcatgaatgtgccacgacacatcaccacctttggccttgaatgccttcatatgctcctcaatatgagccaaatctttatctctgc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55314068 |
agtagagttctctcgtcatgaatgtgccacgacacatcaccacctttggccttgaatgccttcatatgctcctcaatatgagccaaatctttatctctgc |
55313969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4518 times since January 2019
Visitors: 4835