View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0770_low_17 (Length: 271)
Name: NF0770_low_17
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0770_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 42 - 245
Target Start/End: Complemental strand, 35393228 - 35393028
Alignment:
| Q |
42 |
catcatcaattcttttttaattctactttggatcatttgggtgtggactactacatatatgtttccttgcaatgaaaacaaaaaatttccaatatggaat |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35393228 |
catcatcaattcttttttaattctactttggatcatttgggtgtgggctac---atatatgtttccttgcaatgaaaacaaaaaatttccaatatgaaat |
35393132 |
T |
|
| Q |
142 |
tcctaacgttaatgcaatcaacagcatgtatgacggtttagctcactaaattgaattttaaacaaaatataaaaagcttgtttgaattttaagcctatgc |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
35393131 |
tcctaacgttaatgcaatcaacaacatgtatgacggtttagctcactaaattgaattttaaacaagatataaaaagcttgtttgaattttaagcctatac |
35393032 |
T |
|
| Q |
242 |
tact |
245 |
Q |
| |
|
|||| |
|
|
| T |
35393031 |
tact |
35393028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3699 times since January 2019
Visitors: 4818