View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0770_low_18 (Length: 269)

Name: NF0770_low_18
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0770_low_18
NF0770_low_18
[»] chr1 (1 HSPs)
chr1 (129-176)||(21925994-21926041)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 129 - 176
Target Start/End: Complemental strand, 21926041 - 21925994
Alignment:
Q  129 aaatattagaccaaaatcttgcatcgaaagtaagcaacatcaatcttg 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  21926041 aaatattagaccaaaatcttgcatcgaaagtaagcaacatcaatcttg 21925994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University