View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0770_low_24 (Length: 245)
Name: NF0770_low_24
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0770_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 43910175 - 43909948
Alignment:
| Q |
1 |
ccaaatatatttaacctagtaactaattaacaaattaatgttcttattgaattttaagcaatgtagaggatctcttagctaattatcatctttgtggttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43910175 |
ccaaatatatttaacctagtaactaattaacaaattaatgttcttattgaattttaagcaatgtagaggacctcttagctaattatcatctttgtggttg |
43910076 |
T |
|
| Q |
101 |
tccagctcaataaattttatttgtttttgtaaaaatttaatctaactgaggaatcagagtaaaataaagtattaatcaagttacccctttcttcgtaagt |
200 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43910075 |
tccaactcaataaattttgtttgtttttgtaaaaatttaatctaactgaggaaccagagtaaaataaagtattaatcaagttatccctttcttcgtaagt |
43909976 |
T |
|
| Q |
201 |
gaagtaaaatacttcgtataaatgatga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43909975 |
gaagtaaaatacttcgtataaatgatga |
43909948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3163 times since January 2019
Visitors: 4805