View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0770_low_25 (Length: 228)
Name: NF0770_low_25
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0770_low_25 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 31385106 - 31384879
Alignment:
| Q |
1 |
tcatcagtttctttgtcgtaatcattttttattttaacaatttgtcataatcatttgaagtgtcaatccaataacataagacatatagtataataataag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
31385106 |
tcatcagtttctttgtcgtaatcattttttattttaacaatttgtcataatcatttgaagtgtcaatccaataacgtaagacatatagtacaataataag |
31385007 |
T |
|
| Q |
101 |
aaattgtgcattcaacatttttaattatattaagggcacttgttagcatgactctaccttttattaagttttaaaactgtcttagctcatactaaatccc |
200 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31385006 |
aaattgtgcattcaacatttttagttttattaagggaacttgtaagcatgactctaccttttattaagttttaaaactgtcttagctcatacttaatccc |
31384907 |
T |
|
| Q |
201 |
taatccataaagattttggtaaggaaaa |
228 |
Q |
| |
|
||| ||||||||||| ||||||||||| |
|
|
| T |
31384906 |
taagtcataaagatttgggtaaggaaaa |
31384879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3099 times since January 2019
Visitors: 4805