View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0770_low_26 (Length: 224)

Name: NF0770_low_26
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0770_low_26
NF0770_low_26
[»] chr8 (1 HSPs)
chr8 (1-134)||(41930168-41930301)


Alignment Details
Target: chr8 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 41930301 - 41930168
Alignment:
1 tgaaacagacgatgttcaattgggcctatacatagtaagtaacgtgttttaaatgatggaaatacgactcattattgtatgggtgttcctatgtaaacca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| ||    
41930301 tgaaacagacgatgttcaattgggcctatacatagtaagtaacgtgttttaaatgatggaaatatgactcattattgtatgagtgttcctatgtaaatca 41930202  T
101 aagcacacaaaatttcatttagaagatgatgatg 134  Q
    ||||||||||||||||||||||||||||||||||    
41930201 aagcacacaaaatttcatttagaagatgatgatg 41930168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3025 times since January 2019
Visitors: 4805