View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0770_low_27 (Length: 212)
Name: NF0770_low_27
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0770_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 66 - 191
Target Start/End: Original strand, 10758232 - 10758357
Alignment:
Q |
66 |
gcgaggaggataccaccgaacaattcccagacgcaaatctcaaagtcaccagtcaatctgatggaacttctactatgcatgtcccccgttccaaatccaa |
165 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
10758232 |
gcgaggaggataccaccgaacaattcccagacgcaaatctcaaagtcaccagtcaatctgatggaacttcaactatgcatgtcccccgttccaaatccaa |
10758331 |
T |
 |
Q |
166 |
cactcataatcacgatgatgatgatg |
191 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
10758332 |
cactcataatcacgatgatgatgatg |
10758357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 66 - 191
Target Start/End: Original strand, 10971403 - 10971528
Alignment:
Q |
66 |
gcgaggaggataccaccgaacaattcccagacgcaaatctcaaagtcaccagtcaatctgatggaacttctactatgcatgtcccccgttccaaatccaa |
165 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
10971403 |
gcgaggaggataccaccgaacaattcccagacgcaaatctcaaagtcaccagtcaatctgatggaacttcaactatgcatgtcccccgttccaaatccaa |
10971502 |
T |
 |
Q |
166 |
cactcataatcacgatgatgatgatg |
191 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
10971503 |
cactcataatcacgatgatgatgatg |
10971528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University