View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0770_low_5 (Length: 364)
Name: NF0770_low_5
Description: NF0770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0770_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 75 - 330
Target Start/End: Original strand, 28827827 - 28828081
Alignment:
Q |
75 |
ttgaacaagagatttaggatcaaaatgannnnnnnn-accattccatcatcaagtaattttacttttctttctctaagaaactacctaaaggtaaattca |
173 |
Q |
|
|
||||||||||||||||||||||||| || ||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
28827827 |
ttgaacaagagatttaggatcaaaacgatttttttttaccattccatcatgaagtaaattt--ttttctttctctaagaaactacctaaaggtaaattca |
28827924 |
T |
 |
Q |
174 |
tccatgttcatgacatgttaacatggatactagcagttttgaaagatttacaaataggacaaatgtgaagagaagacccacaaacagcacataaacaaag |
273 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28827925 |
tccatgttcatgacatgttaacatggatactagcagttttgaaagatttacaaataggacaaatgtgaagagaagacccacaaacagcacataaacaaag |
28828024 |
T |
 |
Q |
274 |
atgtctacaaggtaaaatcaacacacatgattcatctttcccacagttactgcacag |
330 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28828025 |
atgtctacaaggtaaaatcaacacacatgattcatctttcccacagttactgcacag |
28828081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2883 times since January 2019
Visitors: 4802