View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0771_high_10 (Length: 278)
Name: NF0771_high_10
Description: NF0771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0771_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 49 - 229
Target Start/End: Original strand, 34549860 - 34550040
Alignment:
| Q |
49 |
catcatcaaattcagcatctccgtcactaccttcatcctcaatccaatctataatctcagtatcattatcaccaacaatatcatcatcttcttcatcagg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34549860 |
catcatcaaattcagcatctccgtcactaccttcatcctcaatccaatctataatctcagtatcattatcaccaacaatatcatcatcttcttcatcagg |
34549959 |
T |
 |
| Q |
149 |
agcatcacaaccaagctccatctcttccaacttagccttccactctttagtatatggatgtaaaatttgcaccggatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34549960 |
agcatcacaaccaagctccatctcttccaacttagccttccactctttagtatatggatgtaaaatttgcaccggatgatg |
34550040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University