View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0771_low_10 (Length: 351)
Name: NF0771_low_10
Description: NF0771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0771_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 22 - 351
Target Start/End: Complemental strand, 12495129 - 12494802
Alignment:
| Q |
22 |
catcatcatatactttaaagattggcatttggggatcattttggttataaatcattttggaaaactttaccacattttgttagattttaataatggtgtg |
121 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12495129 |
catcatcatgtactttaaagcttggcatttggggatcattttggttataaatcattttggaaaactttaccacattttgttagattttaataatggtgtg |
12495030 |
T |
 |
| Q |
122 |
tgatattatcatgagaattgctatacttttggtggatgttctcatttgtgtgacagatacatttgcattcaaatgaatgattttggaattatttaatttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12495029 |
--atattatcatgagaattgctatacttttggtggatgttttcatttgtgtgacagatacatttgcattcaaatgaatgattttggaattatttaatttt |
12494932 |
T |
 |
| Q |
222 |
gggtattttaatatacacattctgttatattatgatttttaggcagaacgtgacaacagaaggtctggtagcgattcaaagaaatcttcaactaatacaa |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12494931 |
gggtattttaatatacacattctgttatattatgttttttaggcagaacgtgacaacagaaggtctggtggcgattcaaagaaatcttcaactaatacaa |
12494832 |
T |
 |
| Q |
322 |
aaccatcgaagactttgtttattataaatt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12494831 |
aaccatcgaagactttgtttattataaatt |
12494802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University