View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0771_low_23 (Length: 227)
Name: NF0771_low_23
Description: NF0771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0771_low_23 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 48248144 - 48248376
Alignment:
Q |
1 |
tcatcactcaacaataaaaactcattttctatcctcaactactatacttgatggctttagaattacaaactctgaattcttctcccacaggagctactac |
100 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
48248144 |
tcatcactcaacaacaaaaactcattttctatcctcaactactatacttgatggctttagaattacaaactcttaattcttctcccacaggagctactac |
48248243 |
T |
 |
Q |
101 |
tactat------tccattcccacgtttcaaacaagaagaaaatcaagatcaagaacgtgagtctttggttaaaaagaaacgatcaaaacgaccgc----- |
189 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48248244 |
tactattcctattccattcccacgtttcaaacaagaagaaa------atcaagaacgtgagtctttggttaaaaagaaacgatcaaaacgaccgcgtatt |
48248337 |
T |
 |
Q |
190 |
-gtattggtaacccacccactgaagaagaatatcttgct |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
48248338 |
ggtattggtaacccacccactgaagaagaatatcttgct |
48248376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4013 times since January 2019
Visitors: 4825