View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0771_low_9 (Length: 361)
Name: NF0771_low_9
Description: NF0771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0771_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 53292701 - 53292434
Alignment:
| Q |
1 |
cgtatatttataactatagttaagctacttttacatatttcccttcaattatgtaagtttttgagcttaatgaccaagaaataacnnnnnnnncaaggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53292701 |
cgtatatttataactatagttaagctacttttacatatttcccttcaattatgtaagtttttgagcttaatgaccaagaaataacaaaaaaaacaaggat |
53292602 |
T |
|
| Q |
101 |
tctaagtcggagtacatcagctaggcgagccaaagcgagtgagaagcgaatcataatagaaaatttcaaagttgtatgacaagaaaagtcgttaggggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53292601 |
tctaagtcggagtacatcagctaggcgagccaaagcgagtgagaagcgaatcataatagaaaatttcaaagttgtatgacaagaaaagtcgttaggggag |
53292502 |
T |
|
| Q |
201 |
ctggagcgagagaccccatatagtttacgagaatatgaagagcatattcgctaagcggacaacacatc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53292501 |
ctggagcgagagaccccatatagtttacgagaatatgaagagcatattcgctaagcggacaacacatc |
53292434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 21914271 - 21914315
Alignment:
| Q |
18 |
agttaagctacttttacatatttcccttcaattatgtaagttttt |
62 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
21914271 |
agttaagccacttttacctatttctcttcaattatgtaggttttt |
21914315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4387 times since January 2019
Visitors: 4835