View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0772_low_15 (Length: 315)
Name: NF0772_low_15
Description: NF0772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0772_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 63 - 302
Target Start/End: Complemental strand, 4144107 - 4143868
Alignment:
Q |
63 |
tcgagagttaaaggaaaggaaagcttaacatacctataaataggtatgttttttgcgggcgggcttgggctcaaagcccatgagcttttttccccttctt |
162 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4144107 |
tcgagagttaaaggaaaggaaaacttaacatacctataaataggtatgttttttgcgggtgggcttgggctcaaagcccatgagcttttttccccttctt |
4144008 |
T |
 |
Q |
163 |
atacaggtgcgttagaagtaaattagaggggtgcaaataacaatcctcatcttttcctcttatattaagatgggcccattattatcgggcccaatacagt |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4144007 |
atacaggtgcgttagaagtaaattagaggggtgcaaataacaatcctcatcttttcctcttatattaagatgggcccattattatcgggcccaatacagt |
4143908 |
T |
 |
Q |
263 |
gtgtaatgaactacgttgacggtgccatgctcttcccttc |
302 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4143907 |
gtgtaatgaactacgttgacggtgccatgctcttcccttc |
4143868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University