View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0772_low_17 (Length: 267)
Name: NF0772_low_17
Description: NF0772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0772_low_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 125 - 267
Target Start/End: Complemental strand, 5229031 - 5228889
Alignment:
| Q |
125 |
catgaattaaccaatgtccaatcacataagagggctacaccatccgtcatgataaccaaaaataatatgagtaaattgtctttagccgcggtagcaaagc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||| | |
|
|
| T |
5229031 |
catgaattaaccaatgtccaatcacataagagggctacaccatccgtcatgataaccaaaaacaatatgagtaaattgtctttagtcacggtagcaaaac |
5228932 |
T |
|
| Q |
225 |
aacgtaagattatcgaactgctgaatacttgagctttcgttgt |
267 |
Q |
| |
|
||| ||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
5228931 |
aacttaacattatctaactgctgaatacttgagctttcgttgt |
5228889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3814 times since January 2019
Visitors: 4822