View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0773_high_15 (Length: 268)
Name: NF0773_high_15
Description: NF0773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0773_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 136 - 239
Target Start/End: Original strand, 41071867 - 41071970
Alignment:
| Q |
136 |
atcacctaatagagaatatgataaacatggtggtgttcattgaaagagacaagatgatctgaactattagatctcagtttagtaagaatgacgaacacga |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||| | |||||||||||||||||| | |
|
|
| T |
41071867 |
atcacctaatagagaatatgataaacatggtggtgtttattgaaagagacaagatgatctgaattattagatatcagctcagtaagaatgacgaacacaa |
41071966 |
T |
 |
| Q |
236 |
atta |
239 |
Q |
| |
|
|||| |
|
|
| T |
41071967 |
atta |
41071970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 75
Target Start/End: Original strand, 41071742 - 41071807
Alignment:
| Q |
10 |
aacaatatccactaaattgaatgactttttatatattagggactaattaattattttggatacatt |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41071742 |
aacaatatccactaaattgaatgactttttatatattagggactaattaattattttggatacatt |
41071807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University