View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0773_high_15 (Length: 268)

Name: NF0773_high_15
Description: NF0773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0773_high_15
NF0773_high_15
[»] chr3 (2 HSPs)
chr3 (136-239)||(41071867-41071970)
chr3 (10-75)||(41071742-41071807)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 136 - 239
Target Start/End: Original strand, 41071867 - 41071970
Alignment:
136 atcacctaatagagaatatgataaacatggtggtgttcattgaaagagacaagatgatctgaactattagatctcagtttagtaagaatgacgaacacga 235  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||| | |||||||||||||||||| |    
41071867 atcacctaatagagaatatgataaacatggtggtgtttattgaaagagacaagatgatctgaattattagatatcagctcagtaagaatgacgaacacaa 41071966  T
236 atta 239  Q
    ||||    
41071967 atta 41071970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 10 - 75
Target Start/End: Original strand, 41071742 - 41071807
Alignment:
10 aacaatatccactaaattgaatgactttttatatattagggactaattaattattttggatacatt 75  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41071742 aacaatatccactaaattgaatgactttttatatattagggactaattaattattttggatacatt 41071807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6491 times since January 2019
Visitors: 5768