View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0773_high_7 (Length: 379)
Name: NF0773_high_7
Description: NF0773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0773_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 13 - 68
Target Start/End: Original strand, 47518419 - 47518474
Alignment:
Q |
13 |
aatatctataaatcaagaagcgagctgtaacttattttggaacaaaagtgagttat |
68 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47518419 |
aatatctataaatcaagaagcgagctgtaacttattttggaacaaaagtgagttat |
47518474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University