View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0773_high_9 (Length: 369)
Name: NF0773_high_9
Description: NF0773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0773_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 5 - 281
Target Start/End: Original strand, 15595566 - 15595842
Alignment:
Q |
5 |
tcatgaggcagtaagttggatggactaagaaaacacaagtgcaacagtaagtggaaaatagaatctttagggtggattgaaacgagatgtgatctctcga |
104 |
Q |
|
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
15595566 |
tcatgaggtagtaagttgggtggactaagaaaacacaagtgcaacagtaagtggaaaatagaatctttagggtggattgaaacgagaggtgatctctcga |
15595665 |
T |
 |
Q |
105 |
ttctagggaattaaagaaggaatgataagttaacaaggttcaataagttaatggatgaaagaagataagctaccatgatggtgggtcaaggatgagaata |
204 |
Q |
|
|
||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||| |||| ||||||||||||||||||||| |||||||||||| |
|
|
T |
15595666 |
ttctagggaattaaagaaggaataataagttaagaaggttcagtaagttaatggatgattgaagtcaagctaccatgatggtgggtcgaggatgagaata |
15595765 |
T |
 |
Q |
205 |
tgttaaaggtcagccgaggtctttggatcgagtcttgaggttctactatatgagaagtatcgccaatatgatgatgt |
281 |
Q |
|
|
|||||| ||||||||||| ||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
T |
15595766 |
tgttaagggtcagccgagatctttggattgagtcttgaggttctagtatatgataagtatcgccaatatgatgatgt |
15595842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University