View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0773_low_14 (Length: 341)
Name: NF0773_low_14
Description: NF0773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0773_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 74 - 262
Target Start/End: Original strand, 24326675 - 24326863
Alignment:
| Q |
74 |
agaccaaaggaggaacttgaggaagaacaaagaaagattgaagaggttgccaagaaactttgctgggagaagaagtctgagaaggctgaaattgcaattt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24326675 |
agaccaaaggaggaacttgaggaagaacaaagaaagattgaagaggttgctaagaaactttgctgggagaagaagtctgagaaggctgaaattgcaattt |
24326774 |
T |
 |
| Q |
174 |
ggcaaaagatgacagacactgaatcatgtcgtagcagacaagacgactccagtgtagaattttgcgaatcctcagatcctgatgatgtc |
262 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24326775 |
ggcaaaagatgacagacaccgaatcatgtcgtagcagacaagacgactccagtgtagaattttgcgaatcctcagatcccgatgatgtc |
24326863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 74 - 168
Target Start/End: Complemental strand, 17754710 - 17754616
Alignment:
| Q |
74 |
agaccaaaggaggaacttgaggaagaacaaagaaagattgaagaggttgccaagaaactttgctgggagaagaagtctgagaaggctgaaattgc |
168 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
17754710 |
agacctaaggaggatcttgaggaagaacaaagaaagattgaagatgttgctaagctcctttgctgggagaagaagtccgagaagaatgaaattgc |
17754616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University