View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0773_low_20 (Length: 303)
Name: NF0773_low_20
Description: NF0773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0773_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 11 - 270
Target Start/End: Complemental strand, 49522023 - 49521764
Alignment:
| Q |
11 |
cagagacaaggttgtagtgttactttataccaagacgctcacgtccctgagagtgttcatccgtggattccaatatctggaacaaaatattatgtacctg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49522023 |
cagagacaaggttgtagtgttactttataccaagacgctcacgtccctgagagtgttcatccgtggattccaatatctggaacaaaatattatgtacctg |
49521924 |
T |
|
| Q |
111 |
gaagatgttgggaagatatttacaatgccattatgaatgctaaagtctttatttacataactggttggtctgttcatgcagaaataaccttgattaggga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49521923 |
gaagatgttgggaagatatttacaatgccattatgaatgctaaagtctttatttacataactggttggtctgttcatacagaaataaccttgattaggga |
49521824 |
T |
|
| Q |
211 |
cccaaacaagacaacagaaagtagtatcaccctaggagaaatgctcaagaaaaaagccaa |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49521823 |
cccaaacaagacaacagaaagtagtatcaccctaggagaaatgctcaagaaaaaagccaa |
49521764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 101 - 226
Target Start/End: Complemental strand, 49510989 - 49510864
Alignment:
| Q |
101 |
tatgtacctggaagatgttgggaagatatttacaatgccattatgaatgctaaagtctttatttacataactggttggtctgttcatgcagaaataacct |
200 |
Q |
| |
|
||||| || |||| |||||||||||||| || |||||| |||| ||||||| ||||||| ||||||||||||||||||| | | |||||||||| |
|
|
| T |
49510989 |
tatgtgccgggaaaatgttgggaagatacttgcaatgcaattaatgatgctaagcattttatttgcataactggttggtctgtttacacggaaataacct |
49510890 |
T |
|
| Q |
201 |
tgattagggacccaaacaagacaaca |
226 |
Q |
| |
|
||||||| || |||||| || ||||| |
|
|
| T |
49510889 |
tgattagagatccaaacgagtcaaca |
49510864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6511 times since January 2019
Visitors: 5768