View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0773_low_23 (Length: 274)
Name: NF0773_low_23
Description: NF0773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0773_low_23 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 235 - 274
Target Start/End: Original strand, 5968818 - 5968857
Alignment:
Q |
235 |
agaagtcgttataacttggtttgcatccacgacctgcaac |
274 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
5968818 |
agaagtcattataacttggtttgcatccacgacctgcaac |
5968857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5342 times since January 2019
Visitors: 5756