View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0773_low_23 (Length: 274)

Name: NF0773_low_23
Description: NF0773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0773_low_23
NF0773_low_23
[»] chr3 (1 HSPs)
chr3 (235-274)||(5968818-5968857)


Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 235 - 274
Target Start/End: Original strand, 5968818 - 5968857
Alignment:
235 agaagtcgttataacttggtttgcatccacgacctgcaac 274  Q
    ||||||| ||||||||||||||||||||||||||||||||    
5968818 agaagtcattataacttggtttgcatccacgacctgcaac 5968857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5342 times since January 2019
Visitors: 5756