View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0773_low_29 (Length: 251)

Name: NF0773_low_29
Description: NF0773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0773_low_29
NF0773_low_29
[»] chr4 (1 HSPs)
chr4 (30-63)||(28826144-28826177)
[»] chr2 (1 HSPs)
chr2 (30-63)||(3216967-3217000)


Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 30 - 63
Target Start/End: Complemental strand, 28826177 - 28826144
Alignment:
30 aaataagtatactttattctgctagatttctaca 63  Q
    ||||||||||||||||||||||||||||||||||    
28826177 aaataagtatactttattctgctagatttctaca 28826144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 30 - 63
Target Start/End: Original strand, 3216967 - 3217000
Alignment:
30 aaataagtatactttattctgctagatttctaca 63  Q
    ||||||||||||||||||||||||||||||||||    
3216967 aaataagtatactttattctgctagatttctaca 3217000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5794 times since January 2019
Visitors: 5759