View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_high_9 (Length: 251)
Name: NF0774_high_9
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_high_9 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 24566853 - 24567083
Alignment:
| Q |
20 |
tcgacaattgtgttaaaggttattgccaaggttcaatttataagagtacatattgaatggacagattgaaaaatcttgttaaaaagatatttttaaccat |
119 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24566853 |
tcgacaattgtgttaa-ggttgttgcgaaggttcaatttataagagtacatattgaatggacagattgaaaaatcttgttaaaaagatatttttaaccat |
24566951 |
T |
|
| Q |
120 |
catctatccatagtgacttgcactcagcattcttgactaaatgcatcttcctttatcggaactaaatcaatgattatagaacatggaagaaatctagtat |
219 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
24566952 |
catctatccatagtgacttgcacttagcattcttgactaaatgcatcttcctttatcggaactaaatcaatgatgatagaacatgggagaaatctagtat |
24567051 |
T |
|
| Q |
220 |
tttatggaatgtctatgttattgctcaataat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24567052 |
tttatggaatgtctatgttattgctcaataat |
24567083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6847 times since January 2019
Visitors: 5772