View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_14 (Length: 326)
Name: NF0774_low_14
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 106 - 323
Target Start/End: Complemental strand, 6350466 - 6350249
Alignment:
| Q |
106 |
catgattgctaacaattctttcacattcattcttctaataatccggcttttttgttggtttctcacccattgagtggtgacaatgacactttccgacaag |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6350466 |
catgattggtaacaattctttcacattcattcttctaataatccggcttttttgttggtttctcatccattgagtggtgacaatgacactttccgacaag |
6350367 |
T |
|
| Q |
206 |
gctcaattattcaattgctaggttgcctttgatcaaatttagacaataataattcagctaccggaaacagaggtgtgattacaatagccaagttgaatac |
305 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6350366 |
gctcgattattcaattgctaggttgcctttgatcaaatttagacaataataattcagctaccggaaacagaggtgtgattacaatagccaagttgaatac |
6350267 |
T |
|
| Q |
306 |
aaaaacaaacaaaaatat |
323 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6350266 |
aaaaacaaacaaaaatat |
6350249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6809 times since January 2019
Visitors: 5771