View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0774_low_14 (Length: 326)

Name: NF0774_low_14
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0774_low_14
NF0774_low_14
[»] chr8 (1 HSPs)
chr8 (106-323)||(6350249-6350466)


Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 106 - 323
Target Start/End: Complemental strand, 6350466 - 6350249
Alignment:
106 catgattgctaacaattctttcacattcattcttctaataatccggcttttttgttggtttctcacccattgagtggtgacaatgacactttccgacaag 205  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
6350466 catgattggtaacaattctttcacattcattcttctaataatccggcttttttgttggtttctcatccattgagtggtgacaatgacactttccgacaag 6350367  T
206 gctcaattattcaattgctaggttgcctttgatcaaatttagacaataataattcagctaccggaaacagaggtgtgattacaatagccaagttgaatac 305  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6350366 gctcgattattcaattgctaggttgcctttgatcaaatttagacaataataattcagctaccggaaacagaggtgtgattacaatagccaagttgaatac 6350267  T
306 aaaaacaaacaaaaatat 323  Q
    ||||||||||||||||||    
6350266 aaaaacaaacaaaaatat 6350249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6809 times since January 2019
Visitors: 5771