View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_15 (Length: 325)
Name: NF0774_low_15
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0774_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 30 - 317
Target Start/End: Original strand, 53309030 - 53309317
Alignment:
Q |
30 |
ggatgatgatcttgtctctagtagtgtagttcctgctgtgacagttgtgttggagggccgttcgatctgccaacgcatcagccttcacaaccacggtagc |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53309030 |
ggatgatgatcttgtctctagtagtgtagttcctgctgtgacagttgtgttggagggccgttcgatctgccaacgcatcagccttcacaaccacggtagc |
53309129 |
T |
 |
Q |
130 |
taccaaagtctggccaaggctctccgccagatgtttgtcgattgcacggatgactgcgacgccggtgatcatcatcttgatctttctaatgccattcctg |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53309130 |
taccaaagtctggccaaggctctccgccagatgtttgtcgattgcacggatgactgcgacgccggtgatcatcatcttgatctttctaatgccattcctg |
53309229 |
T |
 |
Q |
230 |
gtcatgttattgcctatgaagacatggagaatgatcttcttcttgctggtgatcttacctggaagtaagcatcgatcttgttcatctc |
317 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53309230 |
gtcatgttattgcctatgaagacatggagaatgatcttcttcttgctggtgatcttacctggaagtaagcatcgatcttgttcatctc |
53309317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6627 times since January 2019
Visitors: 5769