View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_16 (Length: 324)
Name: NF0774_low_16
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 103 - 294
Target Start/End: Complemental strand, 44619565 - 44619374
Alignment:
| Q |
103 |
aaaagatcgccgctttcaatccatgaaacatatgatataatactttttgtccttgttatagttttagtcttatagtattttatctattttggaattaatc |
202 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44619565 |
aaaagatcgccgttttcaatccatgaaacatatgatataatattttttgtccttgttttagttttagtcttgtagtattttatctattttggaattaatc |
44619466 |
T |
|
| Q |
203 |
tttctaatatggggaccatgtttatttaaatctctggaatctggcattttgtgatgatctaattgaaagtatattctctttgtcagcctttg |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44619465 |
tttctaatatggggaccatgtttatttaaatctctggaatctggcatcttgtgatgatctaattgaaagtatattctctttgtcagtctttg |
44619374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6922 times since January 2019
Visitors: 5773