View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_21 (Length: 315)
Name: NF0774_low_21
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 28 - 242
Target Start/End: Original strand, 56378615 - 56378838
Alignment:
| Q |
28 |
acatcatcatgccattcaactacaacataccttctgaatctgatgaacaagaagaggcagcaggtagactacatatgcatc---------atcaacagca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
56378615 |
acatcatcatgccattcaactacaacataccttctgaatctgatgaacaagaagaggcagcaggtagactacatatgcatcatcatcatcatcaacagca |
56378714 |
T |
|
| Q |
119 |
gcagcagcaggaggtagtgatgaagaaaaggttcaggacaaaattcacacaggaacagaaggagaaaatgttgaactttgctgagaaagttggatggaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56378715 |
gcagcagcaggaggtagtgatgaagaaaaggttcaggacaaaattcacacaggaacagaaggagaaaatgttgaactttgctgagaaagttggatggaaa |
56378814 |
T |
|
| Q |
219 |
tttcaaaagcaagaggaatctgtg |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
56378815 |
tttcaaaagcaagaggaatctgtg |
56378838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 217
Target Start/End: Complemental strand, 2494418 - 2494351
Alignment:
| Q |
150 |
ttcaggacaaaattcacacaggaacagaaggagaaaatgttgaactttgctgagaaagttggatggaa |
217 |
Q |
| |
|
||||||||||| || ||||| || |||||||| || ||| |||| ||||||||||||||||| ||||| |
|
|
| T |
2494418 |
ttcaggacaaagtttacacaagatcagaaggataagatgctgaaatttgctgagaaagttgggtggaa |
2494351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 153 - 206
Target Start/End: Complemental strand, 14021574 - 14021521
Alignment:
| Q |
153 |
aggacaaaattcacacaggaacagaaggagaaaatgttgaactttgctgagaaa |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||| || |||||| | || ||||||||| |
|
|
| T |
14021574 |
aggacaaaattcacgcaggaacagaaggataagatgttggagttagctgagaaa |
14021521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7180 times since January 2019
Visitors: 5775