View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0774_low_22 (Length: 314)

Name: NF0774_low_22
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0774_low_22
NF0774_low_22
[»] chr3 (1 HSPs)
chr3 (105-229)||(23914889-23915013)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 105 - 229
Target Start/End: Original strand, 23914889 - 23915013
Alignment:
105 aagaatttggttcaacttttaggttggtgtgttgagaaaggtgaattgttacttgtgtatgagtttatggccaatggtagtttagataagtttcttcata 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
23914889 aagaatttggttcaacttttaggttggtgtgttgagaaaggtgaattgttacttgtgtatgagtttatggttaatggtagtttagataagtttcttcata 23914988  T
205 gagaattatctcatgggtgtgatat 229  Q
    ||||||||||||||| |||||||||    
23914989 gagaattatctcatgagtgtgatat 23915013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6836 times since January 2019
Visitors: 5772