View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_22 (Length: 314)
Name: NF0774_low_22
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 105 - 229
Target Start/End: Original strand, 23914889 - 23915013
Alignment:
| Q |
105 |
aagaatttggttcaacttttaggttggtgtgttgagaaaggtgaattgttacttgtgtatgagtttatggccaatggtagtttagataagtttcttcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23914889 |
aagaatttggttcaacttttaggttggtgtgttgagaaaggtgaattgttacttgtgtatgagtttatggttaatggtagtttagataagtttcttcata |
23914988 |
T |
|
| Q |
205 |
gagaattatctcatgggtgtgatat |
229 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
23914989 |
gagaattatctcatgagtgtgatat |
23915013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6836 times since January 2019
Visitors: 5772