View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_23 (Length: 312)
Name: NF0774_low_23
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_23 |
 | |
|
| [»] scaffold0172 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0172 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: scaffold0172
Description:
Target: scaffold0172; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 8502 - 8301
Alignment:
| Q |
1 |
ttcgccttcattaggggataaaccaaatattgttaatgtgaagaatgaaacgaaacctatcgaacactctagtaaaggttattgtgaagattcagaggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8502 |
ttcgccttcattaggggataaaccaaatattgttaatgtgaagaatgaaacgaaacctatcgaacactctagtaaaggttattgtgaagattcagaggat |
8403 |
T |
|
| Q |
101 |
gacgatgatgataaaccattgagttctaagtggaagatcaaatctaatcatgataagaaagttgtagcccctgttgttatcaagaaatcttctcaagact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8402 |
gacgatgatgataaaccattgagttctaagtggaagatcaaatctaatcatgataacaaagttgtagctcctgttgttatcaagaaatcttctcaagact |
8303 |
T |
|
| Q |
201 |
cg |
202 |
Q |
| |
|
|| |
|
|
| T |
8302 |
cg |
8301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5960 times since January 2019
Visitors: 5761