View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_30 (Length: 284)
Name: NF0774_low_30
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0774_low_30 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 26496470 - 26496723
Alignment:
Q |
1 |
taatattgcctatgaaacacttgcactaacaccgg--acatgaccctgatacgttgatatctgcaatgatttgaaaaatatatgtaattgaatgcaaacg |
98 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
26496470 |
taatattgcctatgaaacacttgcactaacaccggggacatgaccctgatacgttgatatctgcaatgatttgaaaaatatatgtaattgaatgcaatcg |
26496569 |
T |
 |
Q |
99 |
catgtgttggttttatcttgacatcggacaccagatatgccttcaatcttaagtgtatgtgctacatatttaggagttttctaagatgaattaattaaac |
198 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
T |
26496570 |
catgtgttggttttatcttgacatcggacaccagacatgccttcagtcttaagtgtatgtgctacatat---agagttttctaagatgaactaattaaac |
26496666 |
T |
 |
Q |
199 |
atcattgttaacctcttaattttgtgttaaattgaatagttttgtgtgtgcgtactt |
255 |
Q |
|
|
|||||| | | ||| |||||||||||| ||| ||||||||||||||||||||||| |
|
|
T |
26496667 |
atcattactcatctcataattttgtgttctatttaatagttttgtgtgtgcgtactt |
26496723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 251 - 284
Target Start/End: Complemental strand, 5054161 - 5054128
Alignment:
Q |
251 |
tacttagtttctccttatttcattccaatttcca |
284 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
5054161 |
tacttagtttctccttatttcattccaatttcca |
5054128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University