View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_32 (Length: 280)
Name: NF0774_low_32
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 60 - 175
Target Start/End: Original strand, 4823960 - 4824075
Alignment:
| Q |
60 |
catactactccaaactgtgagtaaatagtcatctggtctttaaatatgtgagatagcgtcattatagtctttgaatgaatcgaaacttaaacattcctaa |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4823960 |
catactactccaaactgtgagtaaatagtcatctggtccttaaatatgtgagatagcgtcattatagtctttgaatgaatcgaaacttaaacattcctaa |
4824059 |
T |
 |
| Q |
160 |
gtgtgttttctggacc |
175 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4824060 |
gtgtgttttctggacc |
4824075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 176 - 229
Target Start/End: Original strand, 4824363 - 4824416
Alignment:
| Q |
176 |
ttcctgtcagttacttatagaagtgagtaaacactccaaaattggtacattgaa |
229 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4824363 |
ttcctgtcagtttcttatagaagtgagtaaacactccaaaattggtacattgaa |
4824416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University