View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_34 (Length: 275)
Name: NF0774_low_34
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 40005696 - 40005935
Alignment:
| Q |
1 |
cttgctgttgaagaaaagttttaaagtaaaccttgaattttgttgcctcgtccatatttgattcttataggatcttcataacagtttcttcaatttttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40005696 |
cttgctgttgaagaaaagttttaaagtaaaccttgaattttgttgcctcgtccatatttgattcttataggatcttcagaacagtttcttcaatttttcc |
40005795 |
T |
|
| Q |
101 |
ctgtttgcttcaccaaggctttgaagtgaggctgagggccgagttcgttgtaaggctactttcgaaccttggattctgtagcctcgtgcatatttgattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40005796 |
ctgtttgcttcaccaaggctttgaagtgaggctgagggccgagttcgttgtaaggctactttcgaaccttggattctgtagcctcgtgcatatttgattc |
40005895 |
T |
|
| Q |
201 |
ttctaagatcttcagaacagttttttcgattcttcccttc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40005896 |
ttctaagatcttcagaacagttttttcgattcttcccttc |
40005935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 104 - 232
Target Start/End: Complemental strand, 40006216 - 40006079
Alignment:
| Q |
104 |
tttgcttcaccaaggctttgaagtgaggctgag---------ggccgagttcgttgtaaggctactttcgaaccttggattctgtagcctcgtgcatatt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || || |||||||| ||| |||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
40006216 |
tttgcttcaccaaggctttgaagtgaggctgagataggttgaggtcgggttcgttggaagcctactttcgaaccttggattatgtagcctcatccatatt |
40006117 |
T |
|
| Q |
195 |
tgattcttctaagatcttcagaacagttttttcgattc |
232 |
Q |
| |
|
||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
40006116 |
tgattctagtgagatcttcagaacagtttcctcgattc |
40006079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6828 times since January 2019
Visitors: 5772