View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_35 (Length: 271)
Name: NF0774_low_35
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 33 - 242
Target Start/End: Complemental strand, 32719023 - 32718816
Alignment:
| Q |
33 |
cacagaccagaaatagcagaacgcagcgattgaatcactgcaaacagatggcaaaaacatcgcaggcagccacccccctgaaccaaaaccacttccaaca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32719023 |
cacagaccagaaatagcagaacgcagcgattgaatcactgcaaacagatggcaaaaacattgcaggcagccacccccctgaaccaaaaccgcttccaaca |
32718924 |
T |
 |
| Q |
133 |
aagtacatatttagcgagaagaaacatcccctgatacccctaagcatgctagagaggattcaaccagcactttcaaatcatacttaaactttgacgactt |
232 |
Q |
| |
|
||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32718923 |
aagcacatatttagcgagaacaaacatcccctgatacctctaagcatgct--agagggttcaaccagcactttcaaatcatacttaaactttgacgactc |
32718826 |
T |
 |
| Q |
233 |
taatctctgc |
242 |
Q |
| |
|
|||||||||| |
|
|
| T |
32718825 |
taatctctgc |
32718816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 44 - 239
Target Start/End: Original strand, 9579259 - 9579454
Alignment:
| Q |
44 |
aatagcagaacgcagcgattgaatcactgcaaacagatggca-aaaacatcgcaggcagccacccccctgaaccaaaaccacttccaacaaagtacatat |
142 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| ||| |||||| ||||| |||||||||||||||| |||||| ||||||| || | |||||| |
|
|
| T |
9579259 |
aatagcagaacgcagcgactgcatcactgcaaacagatagcacaaaacaacgcag-cagccacccccctgaaacaaaactgcttccaataatgcacatat |
9579357 |
T |
 |
| Q |
143 |
ttagcgagaagaaacatcccctgatacccctaagcatgctagagaggattcaaccagcact--ttcaaatcatacttaaactttgacgactttaatctc |
239 |
Q |
| |
|
||||| | || |||||||| |||||||||||||||||||| || || ||| |||| |||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
9579358 |
ttagcaaaaacaaacatccactgatacccctaagcatgct--agcgggttcgaccaccactggttcaatccatacataaactttgacgactttaatctc |
9579454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 184
Target Start/End: Original strand, 9584866 - 9584934
Alignment:
| Q |
116 |
caaaaccacttccaacaaagtacatatttagcgagaagaaacatcccctgatacccctaagcatgctag |
184 |
Q |
| |
|
||||||| ||||||| || | | ||||||||| | || |||||||||| |||||||||||||||||||| |
|
|
| T |
9584866 |
caaaaccgcttccaagaatgcaaatatttagcaaaaacaaacatcccccgatacccctaagcatgctag |
9584934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University