View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_36 (Length: 267)
Name: NF0774_low_36
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 25 - 222
Target Start/End: Complemental strand, 16352955 - 16352758
Alignment:
| Q |
25 |
atgaaccaaacggattttctttgatgtgcatgatgatcttgaagaaaaacaccctcccatcttcgctttttgaataaaaccagtctaagcgacaagggtt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16352955 |
atgaaccaaacggattttctttgatgtgcatgatgatcttgaagaaaaacaccctcccatcttcgctttttgaataaaaccagtctaagcgacaagggtt |
16352856 |
T |
|
| Q |
125 |
gaatctcagtggatcctgcaggaagctacttctttgaatgttattgatggagaaggatcaaagtgtagcacttttatatagttcaatatgcatatatt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16352855 |
gaatctcagtggatcctgcaggaagctacttctttgaatgttattgatggagaaggatcaaagtgtagcacttttatatagttcaatatgcatatatt |
16352758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7217 times since January 2019
Visitors: 5775