View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_44 (Length: 234)
Name: NF0774_low_44
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 7948474 - 7948329
Alignment:
| Q |
1 |
gagttgatggatcagtagcagctgataagacaccaagttcttctgcttttgaaaggagaccaagtttctctattgttgagagagataatcctgctttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948474 |
gagttgatggatcagtagcagctgataaaacaccaagttcttctgcttttgaaaggagaccaagtttctctattgttgagagagataatcctgctttctc |
7948375 |
T |
 |
| Q |
101 |
ggctgccgataataaacctgctttctctgccttggttaacagtctc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948374 |
ggctgccgataataaacctgctttctctgccttggttaacagtctc |
7948329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University