View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_48 (Length: 209)
Name: NF0774_low_48
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0774_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 48443461 - 48443337
Alignment:
| Q |
1 |
gtattcttccaacatagtgaatggcaactcatttcccaaatcaatcggcccaatgctttctttcatcaataactctgagaatggagcttgaaagcctgcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48443461 |
gtattcttccaacatagtgaatggcaactcatttcccaaatcaatcggcccaatgctttctttcatcaataactctgagaatggagcttgaaagcctgcc |
48443362 |
T |
|
| Q |
101 |
ttttcaagattaccaccgttctctg |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
48443361 |
ttttcaagattaccaccgttctctg |
48443337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6738 times since January 2019
Visitors: 5771