View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0774_low_8 (Length: 369)
Name: NF0774_low_8
Description: NF0774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0774_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 166; Significance: 9e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 50 - 243
Target Start/End: Complemental strand, 33891058 - 33890865
Alignment:
Q |
50 |
agttccacattgcgtagtctcaagctaactacttctcgccttccaacgaagattggtaccgcggcctcagaccttccgtccttcgtctactgtgaaaaca |
149 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33891058 |
agttccacattgcgtagtctcaagctaattacttctcgccttccaacgaagattggtatcacggcctcagaccttccgtccttcgtctactgtgaaaaca |
33890959 |
T |
 |
Q |
150 |
ttctttctattttctctatcgatttgcccaagttatcaaagttttgcttaactccatggaatttgaagagttagaaattccacgtgcctttgct |
243 |
Q |
|
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
33890958 |
ttctttctatttcatctatcgattcgcccaagttatcaaagttttgcttaactccatggagtttgaagagttagaaattccacgtgcctttgct |
33890865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4779 times since January 2019
Visitors: 5752