View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_high_19 (Length: 287)
Name: NF0775_high_19
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 41 - 275
Target Start/End: Complemental strand, 35379128 - 35378894
Alignment:
| Q |
41 |
catcatcacaaagaagtttcatgagcatggaaggttacttctttaaatgtttgtaggaagttacttctttctttaccaaactttaggttaggttttattc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35379128 |
catcatcacaaagaagtttcatgagcatgggaggttacttctttaaatgtttgtaggaagttacttctttctttaccaaactttaggttaggttttattc |
35379029 |
T |
|
| Q |
141 |
gatggtaagccaacaatgtttctcacttcttatctagaggtctagagggacgttgtcttatggtagtcactacattttttaatatattccgacatgtatt |
240 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35379028 |
gaaggtaagccaacaatgattctcacttcttatctagaggtctagagggacgttgtcttatggtagtcactacattttttaatatattccgacatgtatt |
35378929 |
T |
|
| Q |
241 |
attactaccatgaagaattaaataagttaagtctg |
275 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35378928 |
attactaccttgaagaattaaataagttaagtctg |
35378894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 101 - 140
Target Start/End: Complemental strand, 8146757 - 8146718
Alignment:
| Q |
101 |
ttacttctttctttaccaaactttaggttaggttttattc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8146757 |
ttacttctttctttaccaaactttaggttaagttttattc |
8146718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 84 - 159
Target Start/End: Original strand, 3138078 - 3138153
Alignment:
| Q |
84 |
taaatgtttgtaggaagttacttctttctttaccaaactttaggttaggttttattcgatggtaagccaacaatgt |
159 |
Q |
| |
|
|||||||||||| ||| | | || |||||||| |||||||||| ||| ||||||||||| | ||||||||||||| |
|
|
| T |
3138078 |
taaatgtttgtaagaaatgaattttttctttatcaaactttagattaagttttattcgaagacaagccaacaatgt |
3138153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6551 times since January 2019
Visitors: 5769