View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_high_23 (Length: 267)
Name: NF0775_high_23
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0775_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 47 - 244
Target Start/End: Original strand, 8308567 - 8308764
Alignment:
Q |
47 |
agtaaggtgaaagtaaatcatacctcgggagtgacgaggaatcttctttatataaatgcggaggcgcgtgaccgcctccttaagatgtggcgtgaataca |
146 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
8308567 |
agtaaggtgaaagtaaatcatacctcgggagtgatgaggaatcttctttatataaacgcggaggcgcgtgaccgcctccttaagatgtggtgtgaataca |
8308666 |
T |
 |
Q |
147 |
tgagtctgttagagatgatctggacggtcgagatggagttggggtgtgtggctacatagtcatctgcataaagcttagcatgttccttctctgtgctg |
244 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
8308667 |
tgagtctgttagagatgatctggacggccgagatggagctggggtgtgtggctacatagtcatctgcataaagcttagcatgttccttctctgcgctg |
8308764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 136 - 194
Target Start/End: Complemental strand, 32360067 - 32360009
Alignment:
Q |
136 |
gcgtgaatacatgagtctgttagagatgatctggacggtcgagatggagttggggtgtg |
194 |
Q |
|
|
||||||||| |||||||||||| |||||||||||| |||||| ||||||| ||| |||| |
|
|
T |
32360067 |
gcgtgaatatatgagtctgttaaagatgatctggatggtcgaaatggagtcgggatgtg |
32360009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 136 - 186
Target Start/End: Complemental strand, 12401976 - 12401926
Alignment:
Q |
136 |
gcgtgaatacatgagtctgttagagatgatctggacggtcgagatggagtt |
186 |
Q |
|
|
||||||||| | |||||||||||||||||||||| | ||||| |||||||| |
|
|
T |
12401976 |
gcgtgaatataggagtctgttagagatgatctgggcagtcgaaatggagtt |
12401926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5936 times since January 2019
Visitors: 5761