View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_high_28 (Length: 256)
Name: NF0775_high_28
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_high_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 14 - 256
Target Start/End: Complemental strand, 29004087 - 29003845
Alignment:
| Q |
14 |
agagagcagtcgatgcttaaagcgcgacaaggggttagtgttttgacacttgctgatgttgatgtgaagaatcttgaaacaatggagagtgtggtaagag |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29004087 |
agagagcaatcgatgcttaaagcgcgacaaggggttagtgttttgacacttgctgatgttgatgtgaagaatcttgaaacaatggagagtgtggtaagag |
29003988 |
T |
 |
| Q |
114 |
atgggaaaacaatgggggagattatgttgaagggaagtggaatcatgatggggtattttaaagataaagaagcgacggcgaaagctttcggggatggttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29003987 |
atgggaaaacaatgggggagattatgttgaagggaagtggaatcatgatggggtattttaaagataaagaagcgacggcgaaagctttcggggatggttg |
29003888 |
T |
 |
| Q |
214 |
gtttagaactggtgatgttggtgttatacataaagatggttat |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29003887 |
gtttagaactggtgatgttggtgttatacataaagatggttat |
29003845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University