View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_high_29 (Length: 253)
Name: NF0775_high_29
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 29003636 - 29003413
Alignment:
| Q |
1 |
ctgaggatgagataattacctattgtaggaagaatttaccacactttatggtacctaagatggttatttttatggaggatttaccaaagactttaacagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29003636 |
ctgaggatgagataattacctattgtaggaagaatttaccacactttatggtacctaagatggttgtttttatggaggatttaccaaagactttaacagg |
29003537 |
T |
|
| Q |
101 |
taagattcagaaatttgaattaagagccaaagctaagtgttttgtggtaaatgatgagaagaagaataagaagaagcctaataatcaagtcaatcataat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29003536 |
taagattcagaaatttgaattaagagccaaagctaagtgttttgtggtaaatgatgagaagaagaataataagaagcctaataatcaagtcaatcataat |
29003437 |
T |
|
| Q |
201 |
aatgaccagattatggctctatct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29003436 |
aatgaccagattatggctctatct |
29003413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6525 times since January 2019
Visitors: 5768