View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_high_32 (Length: 228)
Name: NF0775_high_32
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 35508066 - 35508179
Alignment:
| Q |
1 |
gtgtttggaagcttcacaccatgccgcccagaagtgaagccccgccggagaaccgccgcgaacaacctcatccaactccgactttgacttcacgtctcgc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35508066 |
gtgtttggaagcttcacaccatgacgcccagaagtgaagcaccgccggagaaccgccgcgaaccacctcatccaactccgactttgacttcacgtctcgc |
35508165 |
T |
|
| Q |
101 |
accgaaccccccat |
114 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
35508166 |
accgaaccacccat |
35508179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5848 times since January 2019
Visitors: 5760