View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_17 (Length: 377)
Name: NF0775_low_17
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0775_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 37 - 315
Target Start/End: Original strand, 28864526 - 28864804
Alignment:
Q |
37 |
ttgagttcaaaatttcaaatggtgtaaactgttttctccattgtcatggtttgcttttattggttcttttttcacattgtctctcgggagagcaaatgga |
136 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28864526 |
ttgaattcaaaatttcaaatggtgtaaactgttttctccattgtcatggtttgcttttattggttcttttttcacattgtctctcgggagagcaaatgga |
28864625 |
T |
 |
Q |
137 |
tgttgttttaaatttgtaaatgctaacaagtagatctgcccacctcttttttattgatagcaatgaggattgaagagtttagcttcttcttttaggaata |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28864626 |
tgttgttttaaatttgtaaatgctaacaagtagatctgcccacctcttttttattgatagtaatgaggattgaagagtttagcttcttcttttaggaata |
28864725 |
T |
 |
Q |
237 |
cattggcaagtcttgactgaaagagaacctttttaggatatggaaatttcaggttaaatatgtattaatccctgtgaat |
315 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
28864726 |
cattggcaagtcttgactgaaagagaacctttttaggatatggaaatttcaggttaaatatatattaatccctgtgaat |
28864804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 313 - 371
Target Start/End: Original strand, 28865022 - 28865080
Alignment:
Q |
313 |
aatataggtcaaatttacaagaacattatttcgtagcacacgtttgtcagtattatcta |
371 |
Q |
|
|
||||||||||||||||| ||||| |||||||||| ||||||||||||||||||| |||| |
|
|
T |
28865022 |
aatataggtcaaatttaaaagaagattatttcgtggcacacgtttgtcagtattgtcta |
28865080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University