View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0775_low_19 (Length: 345)

Name: NF0775_low_19
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0775_low_19
NF0775_low_19
[»] chr3 (1 HSPs)
chr3 (61-268)||(13565241-13565446)


Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 61 - 268
Target Start/End: Original strand, 13565241 - 13565446
Alignment:
61 gagtgagatgaatgtaatgttagttttacaagtactctttaaactgaaaggattgtttttccctgttttggatttgggtattgtcgttcattaacgctag 160  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
13565241 gagtgagatgaatgtaatgttagttttacaagcactctttaaactga--ggattgtttttccctgttttggatttgggtattgtcgttcattaacgctag 13565338  T
161 attttaatgtactgnnnnnnnngtgtaacaaaatgtggaatggggtactgggtgttgaatttgaggattttggaggtgaaatagaagtatttaggtcttg 260  Q
    ||||| ||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
13565339 atttttatgtactgaaaaaaaagtgtaacaaaatgtggaatggggtactgggtgttgaatttgaggattttggaggtgaaatagaagtatttagggcttg 13565438  T
261 ctgatgat 268  Q
    ||| ||||    
13565439 ctggtgat 13565446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University