View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_19 (Length: 345)
Name: NF0775_low_19
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 61 - 268
Target Start/End: Original strand, 13565241 - 13565446
Alignment:
| Q |
61 |
gagtgagatgaatgtaatgttagttttacaagtactctttaaactgaaaggattgtttttccctgttttggatttgggtattgtcgttcattaacgctag |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13565241 |
gagtgagatgaatgtaatgttagttttacaagcactctttaaactga--ggattgtttttccctgttttggatttgggtattgtcgttcattaacgctag |
13565338 |
T |
|
| Q |
161 |
attttaatgtactgnnnnnnnngtgtaacaaaatgtggaatggggtactgggtgttgaatttgaggattttggaggtgaaatagaagtatttaggtcttg |
260 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13565339 |
atttttatgtactgaaaaaaaagtgtaacaaaatgtggaatggggtactgggtgttgaatttgaggattttggaggtgaaatagaagtatttagggcttg |
13565438 |
T |
|
| Q |
261 |
ctgatgat |
268 |
Q |
| |
|
||| |||| |
|
|
| T |
13565439 |
ctggtgat |
13565446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6068 times since January 2019
Visitors: 5762