View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_30 (Length: 325)
Name: NF0775_low_30
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0775_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 33 - 244
Target Start/End: Original strand, 30360827 - 30361039
Alignment:
Q |
33 |
ctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcattgaaaatatgcatgcttcgaaaag-n |
131 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
30360827 |
ctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcattgaaaatatgcatgcttcgaaatgaa |
30360926 |
T |
 |
Q |
132 |
nnnnnngtcctggttgttaaaatttctttggaagaaaatacgcatgcttnnnnnnngtcttgattgctcactcttttaatactggttgcgccttaaattt |
231 |
Q |
|
|
|||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30360927 |
aaaaaagtcctggttgtttaaatttcttttgaagaaaatacgcatgcttaaaaaaagtcttgattgctcactcttttaatactggttgcgccttaaattt |
30361026 |
T |
 |
Q |
232 |
tctcatctgtgct |
244 |
Q |
|
|
||||||||||||| |
|
|
T |
30361027 |
tctcatctgtgct |
30361039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 33 - 128
Target Start/End: Original strand, 19916226 - 19916321
Alignment:
Q |
33 |
ctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcattgaaaatatgcatgcttcgaaa |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19916226 |
ctggaactgggattgggtccctgcaaggtacattcatatgaaaagaaatttaggctcactacttgtatcatcattgaaaatatgcatgcttcgaaa |
19916321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7145 times since January 2019
Visitors: 5774