View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_43 (Length: 293)
Name: NF0775_low_43
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0775_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 35508001 - 35508179
Alignment:
Q |
1 |
aaccgaaccctaaagaaaggggtaggaggaaaataaagggcaaaaggagagaagagtgggtccatgtgttgggaagcttcaccccatgacgcccagaagt |
100 |
Q |
|
|
||||||||||| |||||| ||||| |||| |||| || ||| ||| ||||||||||| |||||||||||| ||||||||||| ||||||||||||||||| |
|
|
T |
35508001 |
aaccgaacccttaagaaatgggtatgagggaaatcaatggccaaatgagagaagagttggtccatgtgtttggaagcttcacaccatgacgcccagaagt |
35508100 |
T |
 |
Q |
101 |
gaagcaccgccggagaaccgccgcgaacaacctcatccaactccgactttgacttcacgtctcgcaccgaaccccccat |
179 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
35508101 |
gaagcaccgccggagaaccgccgcgaaccacctcatccaactccgactttgacttcacgtctcgcaccgaaccacccat |
35508179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University