View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0775_low_49 (Length: 277)
Name: NF0775_low_49
Description: NF0775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0775_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 13 - 226
Target Start/End: Original strand, 41154052 - 41154267
Alignment:
| Q |
13 |
aatatactagataacttaatttgagatgaagataaatttaagctaatggaccaagtaaacaagtnnnnnnngttcatttacgaattcaagtataactata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41154052 |
aatatactagataacttaatttgagatgaagataaatttaagctaatggaccaagtaaacaagtaaaaaaagttcatttacgaattcaagtataactata |
41154151 |
T |
|
| Q |
113 |
agagtcac--tttttcatatttgacatcaagataaatttaagccaatagaccaagtaaacaagtnnnnnnnnnttcatttacgatttcaaatataggagt |
210 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
41154152 |
agagtcactttttttcatatttgacatcaagataaatttaagtcaatagaccaagtaaacaagtaaaaaaaaatccatttacgatttcaaatataggagt |
41154251 |
T |
|
| Q |
211 |
cacttttttcatatac |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41154252 |
cacttttttcatatac |
41154267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6986 times since January 2019
Visitors: 5773